Beetlejuicing - Images

Sorted By:

Beetlejuiced across platforms | /r/beetlejuicing/

jimmyisawkward 1 hr. ago Tumanwilhame linux > windows Megamind is unattractive 142.234.12.73 Rule rs_hutch 14h ATGCTCTTAGGTCTAGATCTATGGAACTCATCG vevader_3 14h trans rights ✓ 722 - vevader3 14 min. ago 427 - 1 Award Did you just doxx his genetic sequence 483- That vevader_3 seems really cool and funny and sexy

jimmyisawkward 1 hr. ago Tumanwilhame linux > windows Megamind is unattractive 142.234.12.73 Rule rs_hutch 14h ATGCTCTTAGGTCTAGATCTATGGAACTCATCG vevader_3 14h trans rights ✓ 722 - vevader3 14 min. ago 427 - 1 Award Did you just doxx his genetic sequence 483- That vevader_3 seems really cool and funny and sexy

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Dad? | /r/beetlejuicing/

LilSisterCumGutters 5h All the work for an ugly uncomfortable p------------? : Reply Defight556 4h 3 Awards That's what my dad used to say to me! imyourrealdad8 1h I never said this. 01 _The_great_papyrus_ 34m r/usernamechecksout ⠀ 889 413 ↑ 36

LilSisterCumGutters 5h All the work for an ugly uncomfortable p------------? : Reply Defight556 4h 3 Awards That's what my dad used to say to me! imyourrealdad8 1h I never said this. 01 _The_great_papyrus_ 34m r/usernamechecksout ⠀ 889 413 ↑ 36

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Little satisfaction.... | /r/beetlejuicing/

?r/AskReddit u/Acemaster387 • 23h 18 NSFW What went through your head after you lost your virginity? 7313 ↓ 7189 SINGLE COMMENT THREAD Roadhog360 18h Name doesn't check out No_Satisfaction5304 23h H-------- I can't believe we just did that - let's do it again as often as we can manage (and we did) : Reply Little_Satisfaction5 17h At least I have more Share : VIEW ALL 44.5k ↓ 41.3k 4815

?r/AskReddit u/Acemaster387 • 23h 18 NSFW What went through your head after you lost your virginity? 7313 ↓ 7189 SINGLE COMMENT THREAD Roadhog360 18h Name doesn't check out No_Satisfaction5304 23h H-------- I can't believe we just did that - let's do it again as often as we can manage (and we did) : Reply Little_Satisfaction5 17h At least I have more Share : VIEW ALL 44.5k ↓ 41.3k 4815

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Here’s my contribution | /r/beetlejuicing/

< Replies 10 23:01 WM- Gui• 1d ago He definitely got charged for assault when he tried to use that on someone 748 Self-Improvement • 6h ago Romans 10:9 because, if you confess with your mouth that Jesus is Lord and believe in your heart that God raised him from the dead, you will be saved.1 B 5 Jesus Christ • 5h ago Why is bro taking abt me B7 Soviet Union · 35 min ago @Jesus Christ what a coincidence B1 BooyaBoiBoB. 19 min ago @Jesus Christ Imao B x Add a reply... : : ... :

< Replies 10 23:01 WM- Gui• 1d ago He definitely got charged for assault when he tried to use that on someone 748 Self-Improvement • 6h ago Romans 10:9 because, if you confess with your mouth that Jesus is Lord and believe in your heart that God raised him from the dead, you will be saved.1 B 5 Jesus Christ • 5h ago Why is bro taking abt me B7 Soviet Union · 35 min ago @Jesus Christ what a coincidence B1 BooyaBoiBoB. 19 min ago @Jesus Christ Imao B x Add a reply... : : ... :

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Poor gorilla | /r/beetlejuicing/

Not everyone will get this! Would You Rather Be Trapped in a Mall for 24hrs With a Silverback Gorilla or 5 Black Mambas? Mr. Has Sex With Gorillas @ILikeSexWith Gorillas57 Um... I'll pick the gorilla, thanks! ...uh oh! When you notice it! THE GORILLA WHEN IT READS THIS:

Not everyone will get this! Would You Rather Be Trapped in a Mall for 24hrs With a Silverback Gorilla or 5 Black Mambas? Mr. Has Sex With Gorillas @ILikeSexWith Gorillas57 Um... I'll pick the gorilla, thanks! ...uh oh! When you notice it! THE GORILLA WHEN IT READS THIS:

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Timmy!! | /r/beetlejuicing/

delicioussparkalade 11 hr. ago Well Timmy...... 1.8k Reply Share TimmysDrumsticks 10 hr. ago You rang? 788 ... Reply Share delicioussparkalade 10 hr. ago I've been waiting years for this. 341 Reply Share... 42 ... ThatsABigHit 6 hr. ago Ahh the Reddit gods reunite two strangers again! 115 Reply Share CedarWolf 4 hr. ago ThatsABigHit We're gonna need another Timmy! Reply Share ... 39 TimmyFarlight 3 hr. ago + I'm here Reply Share :

delicioussparkalade 11 hr. ago Well Timmy...... 1.8k Reply Share TimmysDrumsticks 10 hr. ago You rang? 788 ... Reply Share delicioussparkalade 10 hr. ago I've been waiting years for this. 341 Reply Share... 42 ... ThatsABigHit 6 hr. ago Ahh the Reddit gods reunite two strangers again! 115 Reply Share CedarWolf 4 hr. ago ThatsABigHit We're gonna need another Timmy! Reply Share ... 39 TimmyFarlight 3 hr. ago + I'm here Reply Share :

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

He slays the younglings. | /r/beetlejuicing/

6:14 ← r/Funnymemes 4464 Bigdongnathaniel 13h Human flesh isn't that ba- 701 3533 JordonKtulu 13h Alfred Packer has entered the chat : : stangster_monny 12h Jeffrey Dahmer enters the chat SlayerOfChildren 12h I have entered the chat 4 people typing... ||| NQ * 483% Add a comment via GIPHY Share Independent-Walruses 10h Reply ⠀ O This is when the fun begins id 4 556 ↓ Award ↑ 76 ↓ GIF ↑ 91 ↓ < 69 ㄱ 유

6:14 ← r/Funnymemes 4464 Bigdongnathaniel 13h Human flesh isn't that ba- 701 3533 JordonKtulu 13h Alfred Packer has entered the chat : : stangster_monny 12h Jeffrey Dahmer enters the chat SlayerOfChildren 12h I have entered the chat 4 people typing... ||| NQ * 483% Add a comment via GIPHY Share Independent-Walruses 10h Reply ⠀ O This is when the fun begins id 4 556 ↓ Award ↑ 76 ↓ GIF ↑ 91 ↓ < 69 ㄱ 유

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Buck Flizzard. | /r/beetlejuicing/

15:34 ←r/diablo4 F--- blizzard Opinion That is all. 01 an 01 849 or r0pd 7 h • good post Alucard8732 7 h True and real. 165 Willing_Ad_5576 6 h Blizz can MaLIGMA balls ● DoctahDonkey 3 h Buck flizzard Oklmpact2752 7 h • Exactly what I want to say Rocco93693 2 h • Quality post. With you on this one : BuckFlizzard1 1 h Did i Hear my Name? B 96 21 Personen anwesend ||| PlasmaNightSky 43 min I love all of this. Made my damn morning Kommentar hinzufügen ...|| 77% Teilen + Auszeichne O : Antworten 4 13 413 ↓ Voten GIF

15:34 ←r/diablo4 F--- blizzard Opinion That is all. 01 an 01 849 or r0pd 7 h • good post Alucard8732 7 h True and real. 165 Willing_Ad_5576 6 h Blizz can MaLIGMA balls ● DoctahDonkey 3 h Buck flizzard Oklmpact2752 7 h • Exactly what I want to say Rocco93693 2 h • Quality post. With you on this one : BuckFlizzard1 1 h Did i Hear my Name? B 96 21 Personen anwesend ||| PlasmaNightSky 43 min I love all of this. Made my damn morning Kommentar hinzufügen ...|| 77% Teilen + Auszeichne O : Antworten 4 13 413 ↓ Voten GIF

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

On r/Oddlyterrifying | /r/beetlejuicing/

46474 ↓ 1 Award Well Timmy...... 00 delicioussparkalade • 10h 673 TimmysDrumsticks. 9h 1 Award You rang? ↑ Share + Reply ... G 1.7k 739

46474 ↓ 1 Award Well Timmy...... 00 delicioussparkalade • 10h 673 TimmysDrumsticks. 9h 1 Award You rang? ↑ Share + Reply ... G 1.7k 739

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Gehrman Estus'd? Hunter Flasked? | /r/beetlejuicing/

←r/Explain The Joke Last night I 249 your sister a 39 Tenryu003 4h 2: . Likely story Share Redacted Herring 11h Pretty sure it's just supposed to... kragrogg 8h. The guy Gehrmann the first hunter from... estus_flasks 6h I am in no way related to what happened... Reply Award 13

←r/Explain The Joke Last night I 249 your sister a 39 Tenryu003 4h 2: . Likely story Share Redacted Herring 11h Pretty sure it's just supposed to... kragrogg 8h. The guy Gehrmann the first hunter from... estus_flasks 6h I am in no way related to what happened... Reply Award 13

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Beetlejuice is best known for his regular appearances on The Howard Stern Show. | /r/beetlejuicing/

Coffe BEETLEJUICE THE COMPLETE SERIES

Coffe BEETLEJUICE THE COMPLETE SERIES

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Timmy! | /r/beetlejuicing/

delicioussparkalade 6h Well Timmy...... TimmysDrumsticks 5h 1 Award : You rang? ⠀ Reply Ĵ 958 431

delicioussparkalade 6h Well Timmy...... TimmysDrumsticks 5h 1 Award : You rang? ⠀ Reply Ĵ 958 431

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Abnormal Humans | /r/beetlejuicing/

47 ↓ Toilets With Threatening Auras Chris Tait 5h. When you're running, the world is your toilet I guess ABNORMAL HUMANS HUTN 2d- #AbnormalHumans NORMAL HUMANS 114 11 Single comment thread MAT TRANDY adidas 26 • 4 hr. ago ↑ Share X 98 comments Freewayshitter 1968 This is one of the best pics of all time 3 ↓ Reply ↑ Share See full discussion

47 ↓ Toilets With Threatening Auras Chris Tait 5h. When you're running, the world is your toilet I guess ABNORMAL HUMANS HUTN 2d- #AbnormalHumans NORMAL HUMANS 114 11 Single comment thread MAT TRANDY adidas 26 • 4 hr. ago ↑ Share X 98 comments Freewayshitter 1968 This is one of the best pics of all time 3 ↓ Reply ↑ Share See full discussion

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Leslie Knope | /r/beetlejuicing/

jaybram24 +1.4h 1 Award This is the Leslie Knope origin story. 682 LeslieKnopeOSRS 3h Sounds exactly like something I would do. 102

jaybram24 +1.4h 1 Award This is the Leslie Knope origin story. 682 LeslieKnopeOSRS 3h Sounds exactly like something I would do. 102

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

Mel’s Hole: Washington’s Frightening Mystery | /r/beetlejuicing/

< 8:05 NewsRadio 610 KONA $10KONA Suggested for you. 11h WSRAD Somewhere between Ellensburg and Manastash Ridge is something out of Stranger Things: A mysterious, never ending hole that seemingly doesn't have a bottom. 610kona.com Mel's Hole: Washington's Frightening Mystery Like 205 126 Shares Most relevant ✓ ww ● Comment KOMO 4 NEWS 88 Share Mel N Well this article headline is awkward... 1h Haha Reply ●●● 7 16

< 8:05 NewsRadio 610 KONA $10KONA Suggested for you. 11h WSRAD Somewhere between Ellensburg and Manastash Ridge is something out of Stranger Things: A mysterious, never ending hole that seemingly doesn't have a bottom. 610kona.com Mel's Hole: Washington's Frightening Mystery Like 205 126 Shares Most relevant ✓ ww ● Comment KOMO 4 NEWS 88 Share Mel N Well this article headline is awkward... 1h Haha Reply ●●● 7 16

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

First time! | /r/beetlejuicing/

Witty_Vacation5098 22h Abyss Ok_Abies_4993 15h Yeah? Reply Actual_Tumbleweed814 Now r/beetlejuicing ● 449 4 4. ↑ 1,

Witty_Vacation5098 22h Abyss Ok_Abies_4993 15h Yeah? Reply Actual_Tumbleweed814 Now r/beetlejuicing ● 449 4 4. ↑ 1,

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

My anaconda don't want nice unless you've got buns hun | /r/beetlejuicing/

Te_Quiero_Puta 2h Bee-bee got back. 31 BeeBeeBounced 23m Oh, gosh, not anymore I don't. 73 Reply + Reply + Akhanyatin 22m r/beetlejuicing 2 2 Reply MyHangyDownPart 11m Undeservedly, I want to be in the screenshot. Reply + : ...

Te_Quiero_Puta 2h Bee-bee got back. 31 BeeBeeBounced 23m Oh, gosh, not anymore I don't. 73 Reply + Reply + Akhanyatin 22m r/beetlejuicing 2 2 Reply MyHangyDownPart 11m Undeservedly, I want to be in the screenshot. Reply + : ...

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

5 years | /r/beetlejuicing/

Poetry /poetry_critics u/Dazzling-Fail-3847 2h Beginner My sunflower Sunflowers stand in groups. I stand with you. Sunflowers mean happiness. You're my happiness. Sunflowers face the light. I face you. ● (This is one of my first poems and idk if it even counts as a poem) 42 ↑ Share FALE 3 Ok_Initial_2180 - 1h Beginner i like it! a strong display of your love in hoest opinion. how old where you when written? Reply 1 Not_an_ar5oni5t. 11m Intermediate It's a poem for sure! I love the last line so much. Sunflowers face the light. I face you. Brilliant! Reply ... TheSunflowerSeeds 11m Beginner The sunflower seeds you eat are encased in inedible black-and-white striped shells, als called hulls. Those used for extracting sunflower oil have solid black shells. ... 1 4 1 +

Poetry /poetry_critics u/Dazzling-Fail-3847 2h Beginner My sunflower Sunflowers stand in groups. I stand with you. Sunflowers mean happiness. You're my happiness. Sunflowers face the light. I face you. ● (This is one of my first poems and idk if it even counts as a poem) 42 ↑ Share FALE 3 Ok_Initial_2180 - 1h Beginner i like it! a strong display of your love in hoest opinion. how old where you when written? Reply 1 Not_an_ar5oni5t. 11m Intermediate It's a poem for sure! I love the last line so much. Sunflowers face the light. I face you. Brilliant! Reply ... TheSunflowerSeeds 11m Beginner The sunflower seeds you eat are encased in inedible black-and-white striped shells, als called hulls. Those used for extracting sunflower oil have solid black shells. ... 1 4 1 +

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

I am Irresistible to men | /r/beetlejuicing/

Sprint LTE Wishing Well Wishing Well 471 BEST COMMENTS ▼ 1:43 PM Add a comment 3 garlic-bread-man • 1d I am irresistible to men 19% wish to be IRRESISTIBLE to men! POOF! ↑ Share >>>

Sprint LTE Wishing Well Wishing Well 471 BEST COMMENTS ▼ 1:43 PM Add a comment 3 garlic-bread-man • 1d I am irresistible to men 19% wish to be IRRESISTIBLE to men! POOF! ↑ Share >>>

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes

He was called. | /r/beetlejuicing/

184 Very_Jesus 3h I was called? Remind Me 3:14PM Jesus calling... 19 Message Share Reply O 47 ♡

184 Very_Jesus 3h I was called? Remind Me 3:14PM Jesus calling... 19 Message Share Reply O 47 ♡

reddit beetlejuicing names /r/beetlejuicing beetlejuice memes